ID: 930429129

View in Genome Browser
Species Human (GRCh38)
Location 2:51251505-51251527
Sequence CAGCTGCCCCTCTGCTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930429129_930429135 28 Left 930429129 2:51251505-51251527 CCCCCTGAGCAGAGGGGCAGCTG No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG 0: 1
1: 0
2: 1
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930429129 Original CRISPR CAGCTGCCCCTCTGCTCAGG GGG (reversed) Intergenic