ID: 930429131

View in Genome Browser
Species Human (GRCh38)
Location 2:51251507-51251529
Sequence TGCAGCTGCCCCTCTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930429131_930429135 26 Left 930429131 2:51251507-51251529 CCCTGAGCAGAGGGGCAGCTGCA No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930429131 Original CRISPR TGCAGCTGCCCCTCTGCTCA GGG (reversed) Intergenic