ID: 930429132

View in Genome Browser
Species Human (GRCh38)
Location 2:51251508-51251530
Sequence GTGCAGCTGCCCCTCTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930429132_930429135 25 Left 930429132 2:51251508-51251530 CCTGAGCAGAGGGGCAGCTGCAC No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930429132 Original CRISPR GTGCAGCTGCCCCTCTGCTC AGG (reversed) Intergenic
No off target data available for this crispr