ID: 930429133

View in Genome Browser
Species Human (GRCh38)
Location 2:51251542-51251564
Sequence GGCAGTGGTATTTGTCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930429133_930429135 -9 Left 930429133 2:51251542-51251564 CCCTGAAGACAAATACCACTGCC No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG No data
930429133_930429141 14 Left 930429133 2:51251542-51251564 CCCTGAAGACAAATACCACTGCC No data
Right 930429141 2:51251579-51251601 CTACAGATTGTTGTGGGTTGAGG No data
930429133_930429142 20 Left 930429133 2:51251542-51251564 CCCTGAAGACAAATACCACTGCC No data
Right 930429142 2:51251585-51251607 ATTGTTGTGGGTTGAGGTGCAGG No data
930429133_930429140 8 Left 930429133 2:51251542-51251564 CCCTGAAGACAAATACCACTGCC No data
Right 930429140 2:51251573-51251595 CTGTGGCTACAGATTGTTGTGGG No data
930429133_930429139 7 Left 930429133 2:51251542-51251564 CCCTGAAGACAAATACCACTGCC No data
Right 930429139 2:51251572-51251594 ACTGTGGCTACAGATTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930429133 Original CRISPR GGCAGTGGTATTTGTCTTCA GGG (reversed) Intergenic
No off target data available for this crispr