ID: 930429134

View in Genome Browser
Species Human (GRCh38)
Location 2:51251543-51251565
Sequence GGGCAGTGGTATTTGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930429134_930429135 -10 Left 930429134 2:51251543-51251565 CCTGAAGACAAATACCACTGCCC No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG No data
930429134_930429140 7 Left 930429134 2:51251543-51251565 CCTGAAGACAAATACCACTGCCC No data
Right 930429140 2:51251573-51251595 CTGTGGCTACAGATTGTTGTGGG No data
930429134_930429141 13 Left 930429134 2:51251543-51251565 CCTGAAGACAAATACCACTGCCC No data
Right 930429141 2:51251579-51251601 CTACAGATTGTTGTGGGTTGAGG No data
930429134_930429139 6 Left 930429134 2:51251543-51251565 CCTGAAGACAAATACCACTGCCC No data
Right 930429139 2:51251572-51251594 ACTGTGGCTACAGATTGTTGTGG No data
930429134_930429142 19 Left 930429134 2:51251543-51251565 CCTGAAGACAAATACCACTGCCC No data
Right 930429142 2:51251585-51251607 ATTGTTGTGGGTTGAGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930429134 Original CRISPR GGGCAGTGGTATTTGTCTTC AGG (reversed) Intergenic
No off target data available for this crispr