ID: 930429135

View in Genome Browser
Species Human (GRCh38)
Location 2:51251556-51251578
Sequence ACCACTGCCCACAACAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930429133_930429135 -9 Left 930429133 2:51251542-51251564 CCCTGAAGACAAATACCACTGCC No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG No data
930429134_930429135 -10 Left 930429134 2:51251543-51251565 CCTGAAGACAAATACCACTGCCC No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG No data
930429129_930429135 28 Left 930429129 2:51251505-51251527 CCCCCTGAGCAGAGGGGCAGCTG No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG No data
930429132_930429135 25 Left 930429132 2:51251508-51251530 CCTGAGCAGAGGGGCAGCTGCAC No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG No data
930429130_930429135 27 Left 930429130 2:51251506-51251528 CCCCTGAGCAGAGGGGCAGCTGC No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG No data
930429131_930429135 26 Left 930429131 2:51251507-51251529 CCCTGAGCAGAGGGGCAGCTGCA No data
Right 930429135 2:51251556-51251578 ACCACTGCCCACAACAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930429135 Original CRISPR ACCACTGCCCACAACAACTG TGG Intergenic
No off target data available for this crispr