ID: 930433684

View in Genome Browser
Species Human (GRCh38)
Location 2:51313970-51313992
Sequence ACCTCAGAAAACAAGCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930433684_930433688 23 Left 930433684 2:51313970-51313992 CCCCATTGCTTGTTTTCTGAGGT No data
Right 930433688 2:51314016-51314038 GATATGCAGCATTATTTCTGAGG 0: 651
1: 2645
2: 4125
3: 3343
4: 4159
930433684_930433687 -5 Left 930433684 2:51313970-51313992 CCCCATTGCTTGTTTTCTGAGGT No data
Right 930433687 2:51313988-51314010 GAGGTTTGTCAAAGATCAGATGG 0: 44
1: 5913
2: 3903
3: 2571
4: 2728
930433684_930433689 24 Left 930433684 2:51313970-51313992 CCCCATTGCTTGTTTTCTGAGGT No data
Right 930433689 2:51314017-51314039 ATATGCAGCATTATTTCTGAGGG 0: 636
1: 2582
2: 3973
3: 2610
4: 3016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930433684 Original CRISPR ACCTCAGAAAACAAGCAATG GGG (reversed) Intergenic
No off target data available for this crispr