ID: 930434979

View in Genome Browser
Species Human (GRCh38)
Location 2:51329416-51329438
Sequence CGACAGATACAGATTGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930434978_930434979 -10 Left 930434978 2:51329403-51329425 CCTGCTTAAAAGTCGACAGATAC No data
Right 930434979 2:51329416-51329438 CGACAGATACAGATTGTGTGAGG No data
930434974_930434979 26 Left 930434974 2:51329367-51329389 CCCAAAGGCTTGTGGGAAAATTG No data
Right 930434979 2:51329416-51329438 CGACAGATACAGATTGTGTGAGG No data
930434975_930434979 25 Left 930434975 2:51329368-51329390 CCAAAGGCTTGTGGGAAAATTGG No data
Right 930434979 2:51329416-51329438 CGACAGATACAGATTGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930434979 Original CRISPR CGACAGATACAGATTGTGTG AGG Intergenic
No off target data available for this crispr