ID: 930435917

View in Genome Browser
Species Human (GRCh38)
Location 2:51341922-51341944
Sequence CTGGTGACTCAGTCTTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930435917_930435919 -7 Left 930435917 2:51341922-51341944 CCATGTTAAGACTGAGTCACCAG No data
Right 930435919 2:51341938-51341960 TCACCAGTATGGTTCTGACAAGG No data
930435917_930435921 6 Left 930435917 2:51341922-51341944 CCATGTTAAGACTGAGTCACCAG No data
Right 930435921 2:51341951-51341973 TCTGACAAGGTTAACTTATGTGG No data
930435917_930435922 29 Left 930435917 2:51341922-51341944 CCATGTTAAGACTGAGTCACCAG No data
Right 930435922 2:51341974-51341996 CTTAAACTGTATATGTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930435917 Original CRISPR CTGGTGACTCAGTCTTAACA TGG (reversed) Intergenic
No off target data available for this crispr