ID: 930435919

View in Genome Browser
Species Human (GRCh38)
Location 2:51341938-51341960
Sequence TCACCAGTATGGTTCTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930435916_930435919 7 Left 930435916 2:51341908-51341930 CCACTCTGACGGAACCATGTTAA No data
Right 930435919 2:51341938-51341960 TCACCAGTATGGTTCTGACAAGG No data
930435917_930435919 -7 Left 930435917 2:51341922-51341944 CCATGTTAAGACTGAGTCACCAG No data
Right 930435919 2:51341938-51341960 TCACCAGTATGGTTCTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930435919 Original CRISPR TCACCAGTATGGTTCTGACA AGG Intergenic
No off target data available for this crispr