ID: 930435920

View in Genome Browser
Species Human (GRCh38)
Location 2:51341941-51341963
Sequence TAACCTTGTCAGAACCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930435920_930435922 10 Left 930435920 2:51341941-51341963 CCAGTATGGTTCTGACAAGGTTA No data
Right 930435922 2:51341974-51341996 CTTAAACTGTATATGTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930435920 Original CRISPR TAACCTTGTCAGAACCATAC TGG (reversed) Intergenic
No off target data available for this crispr