ID: 930440669

View in Genome Browser
Species Human (GRCh38)
Location 2:51401621-51401643
Sequence GTGTTGTAGCATGGAGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930440669_930440671 -4 Left 930440669 2:51401621-51401643 CCTCTATCTCCATGCTACAACAC No data
Right 930440671 2:51401640-51401662 ACACCAAAGCAGTATAAATCAGG No data
930440669_930440676 27 Left 930440669 2:51401621-51401643 CCTCTATCTCCATGCTACAACAC No data
Right 930440676 2:51401671-51401693 TTTACCCCTTTCTTTTCATAGGG No data
930440669_930440675 26 Left 930440669 2:51401621-51401643 CCTCTATCTCCATGCTACAACAC No data
Right 930440675 2:51401670-51401692 GTTTACCCCTTTCTTTTCATAGG No data
930440669_930440677 30 Left 930440669 2:51401621-51401643 CCTCTATCTCCATGCTACAACAC No data
Right 930440677 2:51401674-51401696 ACCCCTTTCTTTTCATAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930440669 Original CRISPR GTGTTGTAGCATGGAGATAG AGG (reversed) Intergenic
No off target data available for this crispr