ID: 930442047

View in Genome Browser
Species Human (GRCh38)
Location 2:51421039-51421061
Sequence CACAGGCACATGCCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930442047_930442056 5 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442056 2:51421067-51421089 AGTTACTTGGGTGGCTGCGGAGG No data
930442047_930442050 -7 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442050 2:51421055-51421077 GCCTGTGGTCCCAGTTACTTGGG 0: 93
1: 4081
2: 47274
3: 180115
4: 263071
930442047_930442054 2 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442054 2:51421064-51421086 CCCAGTTACTTGGGTGGCTGCGG 0: 46
1: 3735
2: 100700
3: 212554
4: 252451
930442047_930442057 6 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442057 2:51421068-51421090 GTTACTTGGGTGGCTGCGGAGGG No data
930442047_930442052 -4 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442052 2:51421058-51421080 TGTGGTCCCAGTTACTTGGGTGG 0: 169
1: 6195
2: 58018
3: 174484
4: 230179
930442047_930442049 -8 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442049 2:51421054-51421076 TGCCTGTGGTCCCAGTTACTTGG 0: 97
1: 4363
2: 43794
3: 143564
4: 150011
930442047_930442058 9 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442058 2:51421071-51421093 ACTTGGGTGGCTGCGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930442047 Original CRISPR CACAGGCACATGCCACCAGC AGG (reversed) Intergenic
No off target data available for this crispr