ID: 930442049

View in Genome Browser
Species Human (GRCh38)
Location 2:51421054-51421076
Sequence TGCCTGTGGTCCCAGTTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 341829
Summary {0: 97, 1: 4363, 2: 43794, 3: 143564, 4: 150011}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930442041_930442049 27 Left 930442041 2:51421004-51421026 CCCCCATCTCTAAAAAAGTAAAA No data
Right 930442049 2:51421054-51421076 TGCCTGTGGTCCCAGTTACTTGG 0: 97
1: 4363
2: 43794
3: 143564
4: 150011
930442043_930442049 25 Left 930442043 2:51421006-51421028 CCCATCTCTAAAAAAGTAAAAAA No data
Right 930442049 2:51421054-51421076 TGCCTGTGGTCCCAGTTACTTGG 0: 97
1: 4363
2: 43794
3: 143564
4: 150011
930442047_930442049 -8 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442049 2:51421054-51421076 TGCCTGTGGTCCCAGTTACTTGG 0: 97
1: 4363
2: 43794
3: 143564
4: 150011
930442042_930442049 26 Left 930442042 2:51421005-51421027 CCCCATCTCTAAAAAAGTAAAAA No data
Right 930442049 2:51421054-51421076 TGCCTGTGGTCCCAGTTACTTGG 0: 97
1: 4363
2: 43794
3: 143564
4: 150011
930442044_930442049 24 Left 930442044 2:51421007-51421029 CCATCTCTAAAAAAGTAAAAAAG No data
Right 930442049 2:51421054-51421076 TGCCTGTGGTCCCAGTTACTTGG 0: 97
1: 4363
2: 43794
3: 143564
4: 150011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930442049 Original CRISPR TGCCTGTGGTCCCAGTTACT TGG Intergenic
Too many off-targets to display for this crispr