ID: 930442050

View in Genome Browser
Species Human (GRCh38)
Location 2:51421055-51421077
Sequence GCCTGTGGTCCCAGTTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 494634
Summary {0: 93, 1: 4081, 2: 47274, 3: 180115, 4: 263071}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930442043_930442050 26 Left 930442043 2:51421006-51421028 CCCATCTCTAAAAAAGTAAAAAA No data
Right 930442050 2:51421055-51421077 GCCTGTGGTCCCAGTTACTTGGG 0: 93
1: 4081
2: 47274
3: 180115
4: 263071
930442041_930442050 28 Left 930442041 2:51421004-51421026 CCCCCATCTCTAAAAAAGTAAAA No data
Right 930442050 2:51421055-51421077 GCCTGTGGTCCCAGTTACTTGGG 0: 93
1: 4081
2: 47274
3: 180115
4: 263071
930442042_930442050 27 Left 930442042 2:51421005-51421027 CCCCATCTCTAAAAAAGTAAAAA No data
Right 930442050 2:51421055-51421077 GCCTGTGGTCCCAGTTACTTGGG 0: 93
1: 4081
2: 47274
3: 180115
4: 263071
930442044_930442050 25 Left 930442044 2:51421007-51421029 CCATCTCTAAAAAAGTAAAAAAG No data
Right 930442050 2:51421055-51421077 GCCTGTGGTCCCAGTTACTTGGG 0: 93
1: 4081
2: 47274
3: 180115
4: 263071
930442047_930442050 -7 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442050 2:51421055-51421077 GCCTGTGGTCCCAGTTACTTGGG 0: 93
1: 4081
2: 47274
3: 180115
4: 263071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930442050 Original CRISPR GCCTGTGGTCCCAGTTACTT GGG Intergenic
Too many off-targets to display for this crispr