ID: 930442052

View in Genome Browser
Species Human (GRCh38)
Location 2:51421058-51421080
Sequence TGTGGTCCCAGTTACTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 469045
Summary {0: 169, 1: 6195, 2: 58018, 3: 174484, 4: 230179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930442047_930442052 -4 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442052 2:51421058-51421080 TGTGGTCCCAGTTACTTGGGTGG 0: 169
1: 6195
2: 58018
3: 174484
4: 230179
930442042_930442052 30 Left 930442042 2:51421005-51421027 CCCCATCTCTAAAAAAGTAAAAA No data
Right 930442052 2:51421058-51421080 TGTGGTCCCAGTTACTTGGGTGG 0: 169
1: 6195
2: 58018
3: 174484
4: 230179
930442043_930442052 29 Left 930442043 2:51421006-51421028 CCCATCTCTAAAAAAGTAAAAAA No data
Right 930442052 2:51421058-51421080 TGTGGTCCCAGTTACTTGGGTGG 0: 169
1: 6195
2: 58018
3: 174484
4: 230179
930442044_930442052 28 Left 930442044 2:51421007-51421029 CCATCTCTAAAAAAGTAAAAAAG No data
Right 930442052 2:51421058-51421080 TGTGGTCCCAGTTACTTGGGTGG 0: 169
1: 6195
2: 58018
3: 174484
4: 230179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930442052 Original CRISPR TGTGGTCCCAGTTACTTGGG TGG Intergenic
Too many off-targets to display for this crispr