ID: 930442054

View in Genome Browser
Species Human (GRCh38)
Location 2:51421064-51421086
Sequence CCCAGTTACTTGGGTGGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 569486
Summary {0: 46, 1: 3735, 2: 100700, 3: 212554, 4: 252451}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930442047_930442054 2 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442054 2:51421064-51421086 CCCAGTTACTTGGGTGGCTGCGG 0: 46
1: 3735
2: 100700
3: 212554
4: 252451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930442054 Original CRISPR CCCAGTTACTTGGGTGGCTG CGG Intergenic
Too many off-targets to display for this crispr