ID: 930442056

View in Genome Browser
Species Human (GRCh38)
Location 2:51421067-51421089
Sequence AGTTACTTGGGTGGCTGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930442047_930442056 5 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442056 2:51421067-51421089 AGTTACTTGGGTGGCTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930442056 Original CRISPR AGTTACTTGGGTGGCTGCGG AGG Intergenic
No off target data available for this crispr