ID: 930442057

View in Genome Browser
Species Human (GRCh38)
Location 2:51421068-51421090
Sequence GTTACTTGGGTGGCTGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930442047_930442057 6 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442057 2:51421068-51421090 GTTACTTGGGTGGCTGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930442057 Original CRISPR GTTACTTGGGTGGCTGCGGA GGG Intergenic
No off target data available for this crispr