ID: 930442058

View in Genome Browser
Species Human (GRCh38)
Location 2:51421071-51421093
Sequence ACTTGGGTGGCTGCGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930442051_930442058 -8 Left 930442051 2:51421056-51421078 CCTGTGGTCCCAGTTACTTGGGT 0: 2
1: 240
2: 6712
3: 61002
4: 179623
Right 930442058 2:51421071-51421093 ACTTGGGTGGCTGCGGAGGGAGG No data
930442047_930442058 9 Left 930442047 2:51421039-51421061 CCTGCTGGTGGCATGTGCCTGTG No data
Right 930442058 2:51421071-51421093 ACTTGGGTGGCTGCGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930442058 Original CRISPR ACTTGGGTGGCTGCGGAGGG AGG Intergenic
No off target data available for this crispr