ID: 930455767

View in Genome Browser
Species Human (GRCh38)
Location 2:51605781-51605803
Sequence GCCGACTGGAGCCACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930455759_930455767 8 Left 930455759 2:51605750-51605772 CCAGTCTCCCTGGCACTGGCAGG No data
Right 930455767 2:51605781-51605803 GCCGACTGGAGCCACAGTGATGG No data
930455763_930455767 1 Left 930455763 2:51605757-51605779 CCCTGGCACTGGCAGGGGAAAAC No data
Right 930455767 2:51605781-51605803 GCCGACTGGAGCCACAGTGATGG No data
930455758_930455767 9 Left 930455758 2:51605749-51605771 CCCAGTCTCCCTGGCACTGGCAG No data
Right 930455767 2:51605781-51605803 GCCGACTGGAGCCACAGTGATGG No data
930455755_930455767 22 Left 930455755 2:51605736-51605758 CCAGTACAAATTGCCCAGTCTCC No data
Right 930455767 2:51605781-51605803 GCCGACTGGAGCCACAGTGATGG No data
930455753_930455767 26 Left 930455753 2:51605732-51605754 CCTCCCAGTACAAATTGCCCAGT No data
Right 930455767 2:51605781-51605803 GCCGACTGGAGCCACAGTGATGG No data
930455754_930455767 23 Left 930455754 2:51605735-51605757 CCCAGTACAAATTGCCCAGTCTC No data
Right 930455767 2:51605781-51605803 GCCGACTGGAGCCACAGTGATGG No data
930455764_930455767 0 Left 930455764 2:51605758-51605780 CCTGGCACTGGCAGGGGAAAACG No data
Right 930455767 2:51605781-51605803 GCCGACTGGAGCCACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930455767 Original CRISPR GCCGACTGGAGCCACAGTGA TGG Intergenic
No off target data available for this crispr