ID: 930460324

View in Genome Browser
Species Human (GRCh38)
Location 2:51665403-51665425
Sequence CTTAGTATAAGACATGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930460324_930460326 -6 Left 930460324 2:51665403-51665425 CCAGACTCATGTCTTATACTAAG No data
Right 930460326 2:51665420-51665442 ACTAAGGAACCAGCTCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930460324 Original CRISPR CTTAGTATAAGACATGAGTC TGG (reversed) Intergenic
No off target data available for this crispr