ID: 930466726

View in Genome Browser
Species Human (GRCh38)
Location 2:51762153-51762175
Sequence CAAGGCCAACTGCAGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930466726 Original CRISPR CAAGGCCAACTGCAGTTTTG AGG Intergenic
907872294 1:58454320-58454342 CAGGAGCAACTGCAGTTTGGGGG + Intronic
908795299 1:67825342-67825364 CTAGGCCATCTGCTGTTTTCTGG - Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
911278426 1:95893321-95893343 CAATGCTCACTGCACTTTTGTGG - Intergenic
912243306 1:107934914-107934936 CCAGGCTATCTGCAGCTTTGAGG + Intronic
912726388 1:112062354-112062376 CATGGACAACTGCAGCTTAGTGG + Intergenic
912826125 1:112905107-112905129 CCAGGCCAACTGCATTTCTTAGG - Intergenic
916715833 1:167446042-167446064 CAAGGACACCTGCAGGTTAGTGG + Intronic
918090676 1:181291385-181291407 AAAGACCAACTACAGCTTTGGGG - Intergenic
922011648 1:221594724-221594746 CAAGGCCTTGTGCAGTTTTTGGG + Intergenic
923246122 1:232134354-232134376 CAAAGGCATATGCAGTTTTGAGG + Intergenic
1064813596 10:19231003-19231025 CTAGGCAAACTTCAGTTTTGAGG - Intronic
1065493033 10:26302049-26302071 CAAGGCCAACTTTAATTTTCTGG - Exonic
1065961907 10:30740456-30740478 CAGGAGCAAGTGCAGTTTTGTGG + Intergenic
1068506399 10:57905362-57905384 CAAGGCCAAGTATAGTTTTTAGG - Intergenic
1068654648 10:59562255-59562277 CAAAGGCAACTGAAGTTTTCCGG - Intergenic
1071202981 10:83241516-83241538 CAATGCCAACTGCAGTCTATGGG - Intergenic
1071991175 10:91102091-91102113 CAAGACCAACTGCAGCAATGAGG + Intergenic
1072659408 10:97354216-97354238 CTTGGCCAACTGCAGGGTTGCGG + Intergenic
1074188975 10:111119444-111119466 CAAGTCCACATGCAGTTTTCTGG - Intergenic
1075552318 10:123401416-123401438 CAAGGAAAAATGCAGTATTGCGG - Intergenic
1078262305 11:9721514-9721536 CAAGCTCAAGTGCAGTGTTGTGG + Intronic
1078799130 11:14624991-14625013 CAAGCCCAACTGCAGCAATGGGG + Intronic
1078829850 11:14968885-14968907 CAACCCCAATTGCAGTTTGGGGG + Exonic
1079550017 11:21683809-21683831 CAAGACCAAGTGCAGTTTCTTGG - Intergenic
1083172452 11:60931009-60931031 AAAGCCCAGCTGCAGTTCTGCGG + Intronic
1083311480 11:61786065-61786087 TCAGGCCAACTGCAGTTCAGAGG + Exonic
1089043888 11:115481833-115481855 GAAGGCCAGCTGAAATTTTGAGG - Intronic
1091793516 12:3284649-3284671 CCAGACCAGCTGCAGTTTGGAGG - Exonic
1093447357 12:19275480-19275502 CAAGGCCAGGCGCAGTTTTTCGG + Intronic
1094497420 12:30997149-30997171 CATGTCCAACTCCAGGTTTGGGG - Intergenic
1096785327 12:54014113-54014135 CCAGGCCAACTCTTGTTTTGTGG + Intronic
1096987856 12:55773576-55773598 CAGGGCACACTGCAGTTATGTGG + Intronic
1097260942 12:57720001-57720023 CAAAGCCAACTGATGTTTTAGGG + Intronic
1098228425 12:68348472-68348494 GAAGGCTAGCTGCTGTTTTGGGG - Intergenic
1099913470 12:88862389-88862411 CAAGGCTCACTCCAGTTTTGGGG - Intergenic
1100224272 12:92540515-92540537 CCAGGGCAATTGCAGTTTGGCGG - Intergenic
1105439246 13:20402122-20402144 CAAGGCCATCTGCAGTTCCCAGG - Intergenic
1109189884 13:59311321-59311343 CAAGGCCAAATGCATTTTTGTGG + Intergenic
1111321991 13:86643797-86643819 CAAGGACAACGGCAGTTATAAGG - Intergenic
1111816703 13:93162969-93162991 ACAGGACAATTGCAGTTTTGAGG - Intergenic
1120115467 14:80612155-80612177 AAAGGCAAACTACATTTTTGTGG - Intronic
1122400273 14:101462919-101462941 CAAGCCCCACTGCAGATTTTGGG + Intergenic
1202891077 14_KI270722v1_random:158634-158656 CAGGGCCACCTGCAGTTATCTGG + Intergenic
1126796914 15:52266966-52266988 CAAAGCCCTCTGGAGTTTTGTGG - Intronic
1127464553 15:59231528-59231550 AAAGGCAAACTGCAGCTTGGCGG + Intronic
1131070555 15:89463088-89463110 CAGAGGCAACTGCAGGTTTGTGG + Intergenic
1132462873 16:63997-64019 CAAGGCCAGCTGCGGTCTAGTGG - Intronic
1133972807 16:10579771-10579793 CCAGGCCAGCTTCAGTTTTGGGG - Intronic
1136608698 16:31353415-31353437 TTAGGCCAACCTCAGTTTTGAGG - Intergenic
1137009042 16:35305500-35305522 CAAGGCCCAGTACAGTGTTGAGG - Intergenic
1144966896 17:19082600-19082622 CCAGGCTGACTGCAGTTGTGCGG + Intergenic
1144981023 17:19169467-19169489 CCAGGCTGACTGCAGTTGTGCGG - Intergenic
1144987201 17:19208772-19208794 CCAGGCTGACTGCAGTTGTGCGG + Intergenic
1148252415 17:46095738-46095760 AAAGGCCAACTACATTTTGGTGG + Intronic
1148723473 17:49771875-49771897 CAGGGACAATTGTAGTTTTGAGG - Intronic
1152310947 17:79549426-79549448 TAGAGCCAACTGCAGCTTTGAGG + Intergenic
1152486596 17:80598511-80598533 GAAGGTCATCTGCAGTTTTTTGG + Intronic
1203169239 17_GL000205v2_random:132353-132375 CAAAGCCAACTCCATTGTTGCGG - Intergenic
1153546398 18:6210177-6210199 TAAGGCCAACTACATATTTGGGG + Intronic
1153952598 18:10069749-10069771 CAAGGCCCACTGCCTCTTTGGGG + Intergenic
1154405252 18:14084657-14084679 GGAGGCTAACTGCAGTTTGGGGG - Intronic
1156158152 18:34328694-34328716 CGAGGCTAACAGCAGATTTGAGG + Intergenic
1156452943 18:37276887-37276909 CATGGCCATTTGCAGTTTTGGGG - Intronic
1157873499 18:51251218-51251240 CAAGGCCAAGTGCAGCTTAAGGG + Intergenic
1159028394 18:63207299-63207321 CACAGCCAGGTGCAGTTTTGTGG - Intronic
1160087840 18:75795436-75795458 CAAGGCCTACTATTGTTTTGTGG + Intergenic
1160397723 18:78584270-78584292 CAGGGGCAACTGCTGCTTTGGGG - Intergenic
1161948751 19:7455415-7455437 CAAGGGCAACGCCACTTTTGGGG - Intronic
1167119560 19:47508371-47508393 CAAGGCCCACTGCAGAGTGGCGG - Intronic
926003954 2:9357146-9357168 CAAGGCCAAATACAGTCTTCAGG - Intronic
926439065 2:12868585-12868607 CAAACTCAACTGCAGTTCTGAGG + Intergenic
928351891 2:30565269-30565291 CAAGGCCAAAGGCAGTCTAGAGG + Intronic
929830103 2:45340181-45340203 AAAGTCCAAATGCAGTCTTGGGG - Intergenic
930466726 2:51762153-51762175 CAAGGCCAACTGCAGTTTTGAGG + Intergenic
931105303 2:59048661-59048683 CAAAGCGAGCTGGAGTTTTGGGG - Intergenic
931560170 2:63552967-63552989 CAAGGCCTTCTGTAGTTTAGTGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935391155 2:102553988-102554010 CAAGACCAGCTGCAGATGTGAGG + Intergenic
938762962 2:134441948-134441970 CAAGGCCAGCTGGAGTCTAGGGG - Intronic
938794282 2:134705254-134705276 CAAATACAACTGCATTTTTGGGG - Intronic
940777170 2:157897166-157897188 TAAGGCTTACTTCAGTTTTGGGG + Intronic
1169146506 20:3255937-3255959 CAGGGCCAACAGCAGCTCTGAGG + Intronic
1169338623 20:4778678-4778700 CAAGGCTTACTGCATTTTGGGGG + Intergenic
1169338674 20:4779284-4779306 CAAGTCCAAAGGCAGTCTTGAGG + Intergenic
1171310366 20:24140411-24140433 CAAGGACAACTGAATTCTTGGGG - Intergenic
1173093019 20:39993859-39993881 CAAGGTCAACTGCACATTTTTGG - Intergenic
1173099431 20:40071184-40071206 CAAGGCAATCTACAGATTTGAGG + Intergenic
1175030904 20:55953067-55953089 CTAGGCTAGCTGCAGTCTTGTGG - Intergenic
1179642403 21:42756351-42756373 CGTGGCCAGATGCAGTTTTGTGG - Intronic
1179914336 21:44466796-44466818 GCCGGCCACCTGCAGTTTTGGGG + Intergenic
1181774888 22:25152290-25152312 CAAGCCCATATGCAGTTTTAAGG + Intronic
1183176757 22:36230048-36230070 CAAGGCCATGTGCAATTTTATGG + Intronic
1183179003 22:36245920-36245942 CAAGGCCATGTGCAATTTTATGG - Intergenic
1183181472 22:36263045-36263067 CAAGGCCATTTGCAATTTTATGG - Intronic
949671849 3:6406593-6406615 CTAGGCCAAGTGCTCTTTTGGGG - Intergenic
949864486 3:8536177-8536199 CAAGGCCAACTGCAGGGATGAGG - Intronic
951301414 3:21001979-21002001 GAAGGCCCACTGGAGGTTTGCGG + Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
951997294 3:28745262-28745284 CAAGGACAAATGTATTTTTGAGG + Intergenic
953916283 3:46923023-46923045 CAAGGCCAACCGCTGTCTTTGGG - Intronic
954364261 3:50137943-50137965 CAAGGCCAATTCCAGATGTGAGG - Intergenic
954960903 3:54564040-54564062 CAAGGCAGACTGCAATTTGGTGG - Intronic
957425748 3:80036824-80036846 CAAGGCCATCTGCACTTGAGTGG + Intergenic
958963229 3:100530340-100530362 CAAAACCAAAGGCAGTTTTGAGG + Intronic
959037574 3:101384529-101384551 CTGGTCCAACTGCAGTCTTGTGG + Intronic
960598857 3:119434943-119434965 CAAGGCCAGCTGTATTTTTATGG + Intronic
963127298 3:141827580-141827602 CTGGTCCATCTGCAGTTTTGAGG - Intergenic
966156384 3:176920948-176920970 CAAGGCCAAATGAAGGTCTGGGG - Intergenic
971567485 4:28163863-28163885 CAAAGCAATCTGCAGATTTGAGG - Intergenic
974919082 4:68214799-68214821 CAAGGGCAACTACATTTTGGAGG + Intergenic
975057526 4:69953129-69953151 AAGGGGCAACTGCAGTTTGGAGG + Intergenic
979776278 4:124592246-124592268 CAGTGCCAACTGCAGTTCTGGGG + Intergenic
980772894 4:137400424-137400446 AATGGACAACTGCAATTTTGGGG + Intergenic
991255202 5:64605729-64605751 TAAGGACAACTGCTGGTTTGGGG - Intronic
994985598 5:106929202-106929224 CATGGCTCACTGCAGTCTTGAGG - Intergenic
995182874 5:109245295-109245317 CAAGACCAACTGCAGCAGTGAGG + Intergenic
997193752 5:131963587-131963609 CAAGGTCATCTCCAGGTTTGGGG - Intronic
998953058 5:147411377-147411399 CAAGCCCAGCTGCAGGCTTGTGG - Intronic
1001067330 5:168546784-168546806 TATGGTCAACTGCACTTTTGGGG + Intergenic
1004807298 6:19217660-19217682 CTAGCACCACTGCAGTTTTGGGG - Intergenic
1006042519 6:31268123-31268145 TCAGGCCAAGTGCTGTTTTGTGG + Intergenic
1006052112 6:31353227-31353249 TCAGGCCAAGTGCTGTTTTGTGG + Intronic
1010744667 6:79547225-79547247 CAAGGACCACTGAGGTTTTGTGG + Intergenic
1015055470 6:128897609-128897631 CAGTTCCAACTGCGGTTTTGGGG - Intronic
1017629249 6:156380497-156380519 CAATACCAAATGCAGATTTGGGG - Intergenic
1017718879 6:157231189-157231211 CAAGGCCAACACCAACTTTGAGG + Intergenic
1018511843 6:164532777-164532799 GAAGGCCAGCTGCAGTCATGGGG + Intergenic
1019405700 7:882759-882781 CCAGGCCAACTGGATTATTGGGG + Intronic
1020469192 7:8516615-8516637 CAAGGCCAACAGCAGAATGGGGG + Intronic
1022246627 7:28566375-28566397 AAAGGCCAAAAGCAGCTTTGAGG + Intronic
1026261500 7:68759434-68759456 CATGGACAAATTCAGTTTTGGGG - Intergenic
1029611193 7:101627495-101627517 CCAGGCCAACTGCAGCTTCAGGG - Intronic
1030075915 7:105736492-105736514 CTATGGCAATTGCAGTTTTGTGG + Intronic
1032770138 7:135044476-135044498 CAAGGCAAAATGGACTTTTGGGG + Intronic
1037378454 8:18258387-18258409 CAAGGCCAACTGCAAATATAAGG + Intergenic
1039146569 8:34453592-34453614 TAAGCCTAACTGTAGTTTTGGGG + Intergenic
1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG + Intergenic
1041950236 8:63492847-63492869 CAAGGAATACTGCAGTTTTCTGG - Intergenic
1042056487 8:64769649-64769671 CAATGCCATCTGCTGTTATGTGG + Intronic
1042461259 8:69071898-69071920 CAAGTCTAACTGCAGATCTGGGG - Intergenic
1042709013 8:71694346-71694368 CCAGGCCATTTGCAGTGTTGTGG - Intergenic
1045003644 8:97899202-97899224 ACAGGCTAAGTGCAGTTTTGGGG - Intronic
1046875346 8:119248888-119248910 CAAGACCAACTGCAGTGATGTGG - Intergenic
1048771293 8:137898254-137898276 CCAGGAGAACTGCAGATTTGAGG - Intergenic
1051601552 9:18879400-18879422 CAAGGCTAAGATCAGTTTTGTGG - Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055500163 9:76895176-76895198 CAAGGCCATCAGCAGTCTTCTGG + Intronic
1055821945 9:80276518-80276540 CAAGTCCAACTGGAGTTTCCTGG - Intergenic
1056346729 9:85704047-85704069 CAAGGCCACCTTTAGTTTTCAGG - Intronic
1056412520 9:86345082-86345104 CAATGCCAACTGCATTTATCTGG + Exonic
1203436896 Un_GL000195v1:146338-146360 CAAAGCCAACTCCATTGTTGCGG + Intergenic
1185950357 X:4425582-4425604 CAAGGTCAACTGCAGGTCTTTGG - Intergenic
1185985652 X:4829514-4829536 TATGACCAACTCCAGTTTTGTGG - Intergenic
1195640999 X:107174617-107174639 AAGGGCCAGCTGTAGTTTTGGGG - Intronic
1197112099 X:122788643-122788665 CAAGGAGAACAGCACTTTTGTGG + Intergenic
1200938267 Y:8757322-8757344 CCTGGCCAACTCCAGATTTGAGG - Intergenic