ID: 930476804

View in Genome Browser
Species Human (GRCh38)
Location 2:51892051-51892073
Sequence AGCCAGAGCCCTCCTGTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930476804_930476808 1 Left 930476804 2:51892051-51892073 CCTCATACAGGAGGGCTCTGGCT No data
Right 930476808 2:51892075-51892097 GCATCCAGCGGGTGCCCCTCTGG No data
930476804_930476814 18 Left 930476804 2:51892051-51892073 CCTCATACAGGAGGGCTCTGGCT No data
Right 930476814 2:51892092-51892114 CTCTGGGACGAAGCTTCCTGAGG No data
930476804_930476809 2 Left 930476804 2:51892051-51892073 CCTCATACAGGAGGGCTCTGGCT No data
Right 930476809 2:51892076-51892098 CATCCAGCGGGTGCCCCTCTGGG No data
930476804_930476815 28 Left 930476804 2:51892051-51892073 CCTCATACAGGAGGGCTCTGGCT No data
Right 930476815 2:51892102-51892124 AAGCTTCCTGAGGAAGAAACAGG No data
930476804_930476807 -10 Left 930476804 2:51892051-51892073 CCTCATACAGGAGGGCTCTGGCT No data
Right 930476807 2:51892064-51892086 GGCTCTGGCTGGCATCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930476804 Original CRISPR AGCCAGAGCCCTCCTGTATG AGG (reversed) Intergenic