ID: 930476810

View in Genome Browser
Species Human (GRCh38)
Location 2:51892079-51892101
Sequence CGTCCCAGAGGGGCACCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930476810_930476814 -10 Left 930476810 2:51892079-51892101 CCAGCGGGTGCCCCTCTGGGACG No data
Right 930476814 2:51892092-51892114 CTCTGGGACGAAGCTTCCTGAGG 0: 2
1: 386
2: 1642
3: 1663
4: 2919
930476810_930476815 0 Left 930476810 2:51892079-51892101 CCAGCGGGTGCCCCTCTGGGACG No data
Right 930476815 2:51892102-51892124 AAGCTTCCTGAGGAAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930476810 Original CRISPR CGTCCCAGAGGGGCACCCGC TGG (reversed) Intergenic
No off target data available for this crispr