ID: 930476811

View in Genome Browser
Species Human (GRCh38)
Location 2:51892089-51892111
Sequence CAGGAAGCTTCGTCCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930476811_930476815 -10 Left 930476811 2:51892089-51892111 CCCCTCTGGGACGAAGCTTCCTG No data
Right 930476815 2:51892102-51892124 AAGCTTCCTGAGGAAGAAACAGG No data
930476811_930476817 23 Left 930476811 2:51892089-51892111 CCCCTCTGGGACGAAGCTTCCTG No data
Right 930476817 2:51892135-51892157 TGCTGTTCTGCAGCCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930476811 Original CRISPR CAGGAAGCTTCGTCCCAGAG GGG (reversed) Intergenic