ID: 930476815

View in Genome Browser
Species Human (GRCh38)
Location 2:51892102-51892124
Sequence AAGCTTCCTGAGGAAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930476811_930476815 -10 Left 930476811 2:51892089-51892111 CCCCTCTGGGACGAAGCTTCCTG No data
Right 930476815 2:51892102-51892124 AAGCTTCCTGAGGAAGAAACAGG No data
930476810_930476815 0 Left 930476810 2:51892079-51892101 CCAGCGGGTGCCCCTCTGGGACG No data
Right 930476815 2:51892102-51892124 AAGCTTCCTGAGGAAGAAACAGG No data
930476804_930476815 28 Left 930476804 2:51892051-51892073 CCTCATACAGGAGGGCTCTGGCT No data
Right 930476815 2:51892102-51892124 AAGCTTCCTGAGGAAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930476815 Original CRISPR AAGCTTCCTGAGGAAGAAAC AGG Intergenic