ID: 930480442

View in Genome Browser
Species Human (GRCh38)
Location 2:51942377-51942399
Sequence AACAGGGTTAACACTTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930480438_930480442 -9 Left 930480438 2:51942363-51942385 CCAGCAAAGGCCCCAACAGGGTT No data
Right 930480442 2:51942377-51942399 AACAGGGTTAACACTTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930480442 Original CRISPR AACAGGGTTAACACTTAAAT TGG Intergenic