ID: 930480444

View in Genome Browser
Species Human (GRCh38)
Location 2:51942399-51942421
Sequence GGAACTTAAAGACGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930480439_930480444 3 Left 930480439 2:51942373-51942395 CCCCAACAGGGTTAACACTTAAA No data
Right 930480444 2:51942399-51942421 GGAACTTAAAGACGAAAAAAAGG No data
930480438_930480444 13 Left 930480438 2:51942363-51942385 CCAGCAAAGGCCCCAACAGGGTT No data
Right 930480444 2:51942399-51942421 GGAACTTAAAGACGAAAAAAAGG No data
930480440_930480444 2 Left 930480440 2:51942374-51942396 CCCAACAGGGTTAACACTTAAAT No data
Right 930480444 2:51942399-51942421 GGAACTTAAAGACGAAAAAAAGG No data
930480441_930480444 1 Left 930480441 2:51942375-51942397 CCAACAGGGTTAACACTTAAATT No data
Right 930480444 2:51942399-51942421 GGAACTTAAAGACGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930480444 Original CRISPR GGAACTTAAAGACGAAAAAA AGG Intergenic