ID: 930491789

View in Genome Browser
Species Human (GRCh38)
Location 2:52082920-52082942
Sequence TATAATGCACAGTTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930491786_930491789 11 Left 930491786 2:52082886-52082908 CCAAAGAACAAAAGAGAAGCAAA No data
Right 930491789 2:52082920-52082942 TATAATGCACAGTTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930491789 Original CRISPR TATAATGCACAGTTGGAGCC TGG Intergenic
No off target data available for this crispr