ID: 930498883

View in Genome Browser
Species Human (GRCh38)
Location 2:52185521-52185543
Sequence GGTTTCGGGGAGCGGTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930498883_930498891 24 Left 930498883 2:52185521-52185543 CCATGACACCGCTCCCCGAAACC No data
Right 930498891 2:52185568-52185590 TACTGTCTGCACTGTGAAAGAGG No data
930498883_930498893 26 Left 930498883 2:52185521-52185543 CCATGACACCGCTCCCCGAAACC No data
Right 930498893 2:52185570-52185592 CTGTCTGCACTGTGAAAGAGGGG No data
930498883_930498892 25 Left 930498883 2:52185521-52185543 CCATGACACCGCTCCCCGAAACC No data
Right 930498892 2:52185569-52185591 ACTGTCTGCACTGTGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930498883 Original CRISPR GGTTTCGGGGAGCGGTGTCA TGG (reversed) Intergenic
No off target data available for this crispr