ID: 930505710

View in Genome Browser
Species Human (GRCh38)
Location 2:52280964-52280986
Sequence GAAGGTGCTATCTGTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930505710_930505714 3 Left 930505710 2:52280964-52280986 CCTGGATCACAGATAGCACCTTC No data
Right 930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG No data
930505710_930505713 -1 Left 930505710 2:52280964-52280986 CCTGGATCACAGATAGCACCTTC No data
Right 930505713 2:52280986-52281008 CTTGCTGTGTTCTCAGATGGAGG No data
930505710_930505716 22 Left 930505710 2:52280964-52280986 CCTGGATCACAGATAGCACCTTC No data
Right 930505716 2:52281009-52281031 AAGGGATGAACAAGCACCCATGG No data
930505710_930505712 -4 Left 930505710 2:52280964-52280986 CCTGGATCACAGATAGCACCTTC No data
Right 930505712 2:52280983-52281005 CTTCTTGCTGTGTTCTCAGATGG No data
930505710_930505715 4 Left 930505710 2:52280964-52280986 CCTGGATCACAGATAGCACCTTC No data
Right 930505715 2:52280991-52281013 TGTGTTCTCAGATGGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930505710 Original CRISPR GAAGGTGCTATCTGTGATCC AGG (reversed) Intergenic
No off target data available for this crispr