ID: 930505714

View in Genome Browser
Species Human (GRCh38)
Location 2:52280990-52281012
Sequence CTGTGTTCTCAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930505710_930505714 3 Left 930505710 2:52280964-52280986 CCTGGATCACAGATAGCACCTTC No data
Right 930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG No data
930505709_930505714 10 Left 930505709 2:52280957-52280979 CCTGTTTCCTGGATCACAGATAG No data
Right 930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930505714 Original CRISPR CTGTGTTCTCAGATGGAGGA AGG Intergenic
No off target data available for this crispr