ID: 930507213

View in Genome Browser
Species Human (GRCh38)
Location 2:52298510-52298532
Sequence TCTAGGAATTTTATAGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930507210_930507213 -4 Left 930507210 2:52298491-52298513 CCGTTGGAAGAAAATGCCATCTA 0: 2
1: 12
2: 24
3: 60
4: 285
Right 930507213 2:52298510-52298532 TCTAGGAATTTTATAGCTAGAGG No data
930507209_930507213 0 Left 930507209 2:52298487-52298509 CCTTCCGTTGGAAGAAAATGCCA No data
Right 930507213 2:52298510-52298532 TCTAGGAATTTTATAGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930507213 Original CRISPR TCTAGGAATTTTATAGCTAG AGG Intergenic
No off target data available for this crispr