ID: 930509814

View in Genome Browser
Species Human (GRCh38)
Location 2:52330301-52330323
Sequence GAACACTGGTTAGCAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930509812_930509814 30 Left 930509812 2:52330248-52330270 CCACATTCTCACTCATATGCAGC No data
Right 930509814 2:52330301-52330323 GAACACTGGTTAGCAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930509814 Original CRISPR GAACACTGGTTAGCAGAGAC TGG Intergenic
No off target data available for this crispr