ID: 930510254

View in Genome Browser
Species Human (GRCh38)
Location 2:52335492-52335514
Sequence AAGAAGGAGCAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930510254_930510257 2 Left 930510254 2:52335492-52335514 CCTTCCTGCTTCTGCTCCTTCTT No data
Right 930510257 2:52335517-52335539 AATGCCAAGATGCTATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930510254 Original CRISPR AAGAAGGAGCAGAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr