ID: 930511542

View in Genome Browser
Species Human (GRCh38)
Location 2:52351333-52351355
Sequence TATGATGCCACGTGTGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930511542_930511545 30 Left 930511542 2:52351333-52351355 CCTACAACACACGTGGCATCATA No data
Right 930511545 2:52351386-52351408 AATAAGTAATCAAAGAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930511542 Original CRISPR TATGATGCCACGTGTGTTGT AGG (reversed) Intergenic
No off target data available for this crispr