ID: 930518161

View in Genome Browser
Species Human (GRCh38)
Location 2:52433205-52433227
Sequence GGTTATGCCGCAAGCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930518161_930518167 13 Left 930518161 2:52433205-52433227 CCTTCCACGCTTGCGGCATAACC No data
Right 930518167 2:52433241-52433263 TAAGGAAACAGGACATTGGAAGG No data
930518161_930518165 2 Left 930518161 2:52433205-52433227 CCTTCCACGCTTGCGGCATAACC No data
Right 930518165 2:52433230-52433252 TGTGCTTACTGTAAGGAAACAGG No data
930518161_930518166 9 Left 930518161 2:52433205-52433227 CCTTCCACGCTTGCGGCATAACC No data
Right 930518166 2:52433237-52433259 ACTGTAAGGAAACAGGACATTGG No data
930518161_930518163 -5 Left 930518161 2:52433205-52433227 CCTTCCACGCTTGCGGCATAACC No data
Right 930518163 2:52433223-52433245 TAACCAGTGTGCTTACTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930518161 Original CRISPR GGTTATGCCGCAAGCGTGGA AGG (reversed) Intergenic
No off target data available for this crispr