ID: 930523169

View in Genome Browser
Species Human (GRCh38)
Location 2:52493798-52493820
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930523169_930523180 6 Left 930523169 2:52493798-52493820 CCTGCAGCCCTCAGTTTACCCAG No data
Right 930523180 2:52493827-52493849 TAATGGAAACATGCTTGGGTAGG No data
930523169_930523179 2 Left 930523169 2:52493798-52493820 CCTGCAGCCCTCAGTTTACCCAG No data
Right 930523179 2:52493823-52493845 CCTCTAATGGAAACATGCTTGGG No data
930523169_930523177 1 Left 930523169 2:52493798-52493820 CCTGCAGCCCTCAGTTTACCCAG No data
Right 930523177 2:52493822-52493844 CCCTCTAATGGAAACATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930523169 Original CRISPR CTGGGTAAACTGAGGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr