ID: 930525156

View in Genome Browser
Species Human (GRCh38)
Location 2:52519536-52519558
Sequence CTGTATTAGCAGCATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930525155_930525156 -7 Left 930525155 2:52519520-52519542 CCAGTCTTGGGGATGTCTGTATT No data
Right 930525156 2:52519536-52519558 CTGTATTAGCAGCATGAGAATGG No data
930525151_930525156 7 Left 930525151 2:52519506-52519528 CCTTTATAAATTATCCAGTCTTG 0: 111
1: 1630
2: 2781
3: 4257
4: 3678
Right 930525156 2:52519536-52519558 CTGTATTAGCAGCATGAGAATGG No data
930525150_930525156 14 Left 930525150 2:52519499-52519521 CCTCTTTCCTTTATAAATTATCC 0: 277
1: 4268
2: 8719
3: 9110
4: 8100
Right 930525156 2:52519536-52519558 CTGTATTAGCAGCATGAGAATGG No data
930525149_930525156 15 Left 930525149 2:52519498-52519520 CCCTCTTTCCTTTATAAATTATC No data
Right 930525156 2:52519536-52519558 CTGTATTAGCAGCATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930525156 Original CRISPR CTGTATTAGCAGCATGAGAA TGG Intergenic
No off target data available for this crispr