ID: 930525281

View in Genome Browser
Species Human (GRCh38)
Location 2:52521364-52521386
Sequence AAGGGTCTTTTATACTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930525276_930525281 10 Left 930525276 2:52521331-52521353 CCTTCTCTGACATATGATCTTTC No data
Right 930525281 2:52521364-52521386 AAGGGTCTTTTATACTCTGGTGG No data
930525275_930525281 11 Left 930525275 2:52521330-52521352 CCCTTCTCTGACATATGATCTTT No data
Right 930525281 2:52521364-52521386 AAGGGTCTTTTATACTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930525281 Original CRISPR AAGGGTCTTTTATACTCTGG TGG Intergenic
No off target data available for this crispr