ID: 930527549

View in Genome Browser
Species Human (GRCh38)
Location 2:52548819-52548841
Sequence ACTTTGGGGTAAATGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527549_930527558 18 Left 930527549 2:52548819-52548841 CCAGGCAGCATTTACCCCAAAGT No data
Right 930527558 2:52548860-52548882 TTTAAGAGAAACTTGGCACTGGG No data
930527549_930527556 11 Left 930527549 2:52548819-52548841 CCAGGCAGCATTTACCCCAAAGT No data
Right 930527556 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
930527549_930527553 -7 Left 930527549 2:52548819-52548841 CCAGGCAGCATTTACCCCAAAGT No data
Right 930527553 2:52548835-52548857 CCAAAGTGACTGAAGAGACCTGG No data
930527549_930527559 29 Left 930527549 2:52548819-52548841 CCAGGCAGCATTTACCCCAAAGT No data
Right 930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG No data
930527549_930527557 17 Left 930527549 2:52548819-52548841 CCAGGCAGCATTTACCCCAAAGT No data
Right 930527557 2:52548859-52548881 CTTTAAGAGAAACTTGGCACTGG No data
930527549_930527554 -6 Left 930527549 2:52548819-52548841 CCAGGCAGCATTTACCCCAAAGT No data
Right 930527554 2:52548836-52548858 CAAAGTGACTGAAGAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527549 Original CRISPR ACTTTGGGGTAAATGCTGCC TGG (reversed) Intergenic