ID: 930527550

View in Genome Browser
Species Human (GRCh38)
Location 2:52548833-52548855
Sequence AGGTCTCTTCAGTCACTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527550_930527556 -3 Left 930527550 2:52548833-52548855 CCCCAAAGTGACTGAAGAGACCT No data
Right 930527556 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
930527550_930527557 3 Left 930527550 2:52548833-52548855 CCCCAAAGTGACTGAAGAGACCT No data
Right 930527557 2:52548859-52548881 CTTTAAGAGAAACTTGGCACTGG No data
930527550_930527558 4 Left 930527550 2:52548833-52548855 CCCCAAAGTGACTGAAGAGACCT No data
Right 930527558 2:52548860-52548882 TTTAAGAGAAACTTGGCACTGGG No data
930527550_930527559 15 Left 930527550 2:52548833-52548855 CCCCAAAGTGACTGAAGAGACCT No data
Right 930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG No data
930527550_930527560 30 Left 930527550 2:52548833-52548855 CCCCAAAGTGACTGAAGAGACCT No data
Right 930527560 2:52548886-52548908 TAATCTGGCAGTACTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527550 Original CRISPR AGGTCTCTTCAGTCACTTTG GGG (reversed) Intergenic