ID: 930527551

View in Genome Browser
Species Human (GRCh38)
Location 2:52548834-52548856
Sequence CAGGTCTCTTCAGTCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527551_930527559 14 Left 930527551 2:52548834-52548856 CCCAAAGTGACTGAAGAGACCTG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG No data
930527551_930527561 30 Left 930527551 2:52548834-52548856 CCCAAAGTGACTGAAGAGACCTG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 930527561 2:52548887-52548909 AATCTGGCAGTACTCCCCATGGG No data
930527551_930527557 2 Left 930527551 2:52548834-52548856 CCCAAAGTGACTGAAGAGACCTG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 930527557 2:52548859-52548881 CTTTAAGAGAAACTTGGCACTGG No data
930527551_930527558 3 Left 930527551 2:52548834-52548856 CCCAAAGTGACTGAAGAGACCTG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 930527558 2:52548860-52548882 TTTAAGAGAAACTTGGCACTGGG No data
930527551_930527560 29 Left 930527551 2:52548834-52548856 CCCAAAGTGACTGAAGAGACCTG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 930527560 2:52548886-52548908 TAATCTGGCAGTACTCCCCATGG No data
930527551_930527556 -4 Left 930527551 2:52548834-52548856 CCCAAAGTGACTGAAGAGACCTG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 930527556 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527551 Original CRISPR CAGGTCTCTTCAGTCACTTT GGG (reversed) Intergenic