ID: 930527552

View in Genome Browser
Species Human (GRCh38)
Location 2:52548835-52548857
Sequence CCAGGTCTCTTCAGTCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527552_930527560 28 Left 930527552 2:52548835-52548857 CCAAAGTGACTGAAGAGACCTGG No data
Right 930527560 2:52548886-52548908 TAATCTGGCAGTACTCCCCATGG No data
930527552_930527557 1 Left 930527552 2:52548835-52548857 CCAAAGTGACTGAAGAGACCTGG No data
Right 930527557 2:52548859-52548881 CTTTAAGAGAAACTTGGCACTGG No data
930527552_930527558 2 Left 930527552 2:52548835-52548857 CCAAAGTGACTGAAGAGACCTGG No data
Right 930527558 2:52548860-52548882 TTTAAGAGAAACTTGGCACTGGG No data
930527552_930527561 29 Left 930527552 2:52548835-52548857 CCAAAGTGACTGAAGAGACCTGG No data
Right 930527561 2:52548887-52548909 AATCTGGCAGTACTCCCCATGGG No data
930527552_930527556 -5 Left 930527552 2:52548835-52548857 CCAAAGTGACTGAAGAGACCTGG No data
Right 930527556 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
930527552_930527559 13 Left 930527552 2:52548835-52548857 CCAAAGTGACTGAAGAGACCTGG No data
Right 930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527552 Original CRISPR CCAGGTCTCTTCAGTCACTT TGG (reversed) Intergenic