ID: 930527555

View in Genome Browser
Species Human (GRCh38)
Location 2:52548853-52548875
Sequence CCAAGTTTCTCTTAAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527555_930527561 11 Left 930527555 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
Right 930527561 2:52548887-52548909 AATCTGGCAGTACTCCCCATGGG No data
930527555_930527562 18 Left 930527555 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
Right 930527562 2:52548894-52548916 CAGTACTCCCCATGGGCTTGTGG No data
930527555_930527564 24 Left 930527555 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
Right 930527564 2:52548900-52548922 TCCCCATGGGCTTGTGGTGGTGG No data
930527555_930527563 21 Left 930527555 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
Right 930527563 2:52548897-52548919 TACTCCCCATGGGCTTGTGGTGG No data
930527555_930527560 10 Left 930527555 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
Right 930527560 2:52548886-52548908 TAATCTGGCAGTACTCCCCATGG No data
930527555_930527559 -5 Left 930527555 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
Right 930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG No data
930527555_930527568 27 Left 930527555 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
Right 930527568 2:52548903-52548925 CCATGGGCTTGTGGTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527555 Original CRISPR CCAAGTTTCTCTTAAAGCCC AGG (reversed) Intergenic