ID: 930527559

View in Genome Browser
Species Human (GRCh38)
Location 2:52548871-52548893
Sequence CTTGGCACTGGGCAGTAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527549_930527559 29 Left 930527549 2:52548819-52548841 CCAGGCAGCATTTACCCCAAAGT No data
Right 930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG No data
930527551_930527559 14 Left 930527551 2:52548834-52548856 CCCAAAGTGACTGAAGAGACCTG No data
Right 930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG No data
930527555_930527559 -5 Left 930527555 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
Right 930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG No data
930527550_930527559 15 Left 930527550 2:52548833-52548855 CCCCAAAGTGACTGAAGAGACCT No data
Right 930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG No data
930527552_930527559 13 Left 930527552 2:52548835-52548857 CCAAAGTGACTGAAGAGACCTGG No data
Right 930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527559 Original CRISPR CTTGGCACTGGGCAGTAATC TGG Intergenic