ID: 930527561

View in Genome Browser
Species Human (GRCh38)
Location 2:52548887-52548909
Sequence AATCTGGCAGTACTCCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527555_930527561 11 Left 930527555 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
Right 930527561 2:52548887-52548909 AATCTGGCAGTACTCCCCATGGG No data
930527552_930527561 29 Left 930527552 2:52548835-52548857 CCAAAGTGACTGAAGAGACCTGG No data
Right 930527561 2:52548887-52548909 AATCTGGCAGTACTCCCCATGGG No data
930527551_930527561 30 Left 930527551 2:52548834-52548856 CCCAAAGTGACTGAAGAGACCTG No data
Right 930527561 2:52548887-52548909 AATCTGGCAGTACTCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527561 Original CRISPR AATCTGGCAGTACTCCCCAT GGG Intergenic