ID: 930527564

View in Genome Browser
Species Human (GRCh38)
Location 2:52548900-52548922
Sequence TCCCCATGGGCTTGTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527555_930527564 24 Left 930527555 2:52548853-52548875 CCTGGGCTTTAAGAGAAACTTGG No data
Right 930527564 2:52548900-52548922 TCCCCATGGGCTTGTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527564 Original CRISPR TCCCCATGGGCTTGTGGTGG TGG Intergenic