ID: 930527762

View in Genome Browser
Species Human (GRCh38)
Location 2:52551575-52551597
Sequence GTGTATTCTGCAACCATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527762_930527764 28 Left 930527762 2:52551575-52551597 CCTCTAATGGTTGCAGAATACAC No data
Right 930527764 2:52551626-52551648 TCAAGATTAAATCATATGTTAGG No data
930527762_930527763 -2 Left 930527762 2:52551575-52551597 CCTCTAATGGTTGCAGAATACAC No data
Right 930527763 2:52551596-52551618 ACATTCTTTTCTTCAGCACATGG 0: 18
1: 271
2: 900
3: 1544
4: 1894

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527762 Original CRISPR GTGTATTCTGCAACCATTAG AGG (reversed) Intergenic
No off target data available for this crispr